mouse nsc nucleofector kit (Lonza)

Lonza is a verified supplier

Lonza manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Lonza mouse nsc nucleofector kit
Mouse Nsc Nucleofector Kit, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+nsc+nucleofector+kit/mouse+es+cell+nucleofector+kit/pm37605090-48-20-24
Average 90 stars, based on 1 article reviews

mouse nsc nucleofector kit - by Bioz Stars, 2026-11

90/100 stars

Images

Transfection:

Article Title: Extracellular vesicles from neural progenitor cells promote functional recovery after stroke in mice with pharmacological inhibition of neurogenesis
Article Snippet: Immunofluorescence was visualized using a Zeiss LSM 800 II Microscope. .. Following the manufacturer instructions, NPCs were transfected with HRE-luciferase and pEGFP-N1 plasmids with the mouse NSC nucleofector kit (Lonza, Basel, Switzerland). .. HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid #26731; RRID: Addgene_26731) [ ], and pEGFP-N1 was a gift from Félix Recillas (IFC-UNAM).

Article Title: Dbx2, an Aging-Related Homeobox Gene, Inhibits the Proliferation of Adult Neural Progenitors.
Article Snippet: .. Briefly, NSPC transfection of young adult SVZ NSPCs with pTP6-hrGFP or pTP6-Dbx2 plasmids was previously carried out using an Amaxa mouse NSC Nucleofector kit (Lonza VPG-1004) on an Amaxa Nucleofector II (Lonza), followed by selection and maintenance of transgenic NSPCs by treatment with puromycin (Sigma-Aldrich P8833, 1 μg/ ml). ..

Article Title: Extracellular vesicles from neural progenitor cells promote functional recovery after stroke in mice with pharmacological inhibition of neurogenesis.
Article Snippet: Immunofluorescence was visualized using a Zeiss LSM 800 II Microscope. .. Following the manufacturer instructions, NPCs were transfected with HREluciferase and pEGFP-N1 plasmids with the mouse NSC nucleofector kit (Lonza, Basel, Switzerland). .. HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid #26731; RRID: Addgene_26731) [65], and pEGFP-N1 was a gift from Félix Recillas (IFC-UNAM).

Article Title: Osteopontin mediates glioblastoma-associated macrophage infiltration and is a potential therapeutic target
Article Snippet: Briefly, pSpCas9 BB-2A-GFP (PX458, GenScript) plasmids for expression of 2 sgRNA sequences specific to the OPN exome genome (sgRNA targeting sequences: ATCAGAGTCGTTCGAGTCAA and TGGCTTTCGTTGGACTTACT) as well as an NT PX458 plasmid (sgRNA targeting sequence: CGCTTCCGCGGCCCGTTCAA) were designed by a member of our research team and incorporated into PX458 (at GenScript). .. The PX458 plasmids (2 μg each) were then transfected into the GSCs using the Amaxa mouse NSC Nucleofector kit (program A-033, Lonza). .. On day 4 after electroporation, GFP + cells were sorted and seeded as single cells into 96-well plates by a FACSAria Sorter (BD Biosciences).

Article Title: FGF2 and insulin signaling converge to regulate cyclin D expression in multipotent neural stem cells.
Article Snippet: Flow cytometry was performed with FACScaliber system and data were analyzed with the software Flowjo (http://www.flowjo.com, Ashland, OR). .. Cells (5 3 106) were transfected with 1 mM siRNA using the Mouse NSC Nucleofector kit from Lonza (http://www.lonza. com, Basel Switzerland). ..

Article Title: Neuroregenerative Potential of Prenyl- and Pyranochalcones: A Structure-Activity Study.
Article Snippet: Loss of neuronal tissue is a hallmark of age-related neurodegenerative diseases.. Since adult neurogenesis has been confirmed in the human brain, great interest has arisen in substances stimulating the endogenous neuronal regeneration mechanism based on adult neural stem cells.. Medicinal plants are a valuable source of neuroactive small molecules.

Selection:

Transgenic Assay:

other:

Article Title: Differences in Mitotic Spindle Architecture in Mammalian Neural Stem Cells Influence Mitotic Accuracy during Brain Development.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBLBP-EGFP plasmid Laboratory of F.Francis (IFM, Paris, France); [66] N/A pEGFP-C1 plasmid Clontech https://www.addgene.org/vector-database/2487 TPX2 (NM_012112) Human untagged clone Origene Cat#SC115515 Mus musculus Centrin3; IMAGE clone ID: 30019209 Thermo Fisher Scientific Biosciences Cat#MMM1013-202805556 Mus musculus Cep135; IMAGE clone ID: 6852711 Thermo Fisher Scientific Biosciences Cat#MMM1013-202859840 hCep192 containing plasmid Laboratory of A.Dammermann (MPL, Vienna, Austria) N/A Mus musculus Kifc1/HSET; IMAGE clone ID: 30841951 Thermo Fisher Scientific Biosciences Cat#MMM1013-202780075 Software and Algorithms Fiji software for image analysis Open source image processing software http://imagej.net/Contributors; RRID: SCR_002285 NIS Elements viewer software v4.3.02 Nikon; [67] N/A Prism software for graphs and statistical analysis, version 7 GrapPad Software N/A Affinity Designer Affinity https://affinity.serif.com/en-us/designer/ RRID: SCR_016952 Affinity Photo Affinity https://affinity.serif.com/en-us/photo/ RRID: SCR_016951 Other DMEM/HamF12 powder GIBCO Cat#42400-028 DMEM/F12 GIBCO Cat#11320-033 Sodium bicarbonate Sigma Cat#S5761 Glucose Sigma Cat#G6152 B27 supplement w/o vitamin A ThermoFisher Scientific Cat#12587-010 N2 supplement GIBCO Cat#17502-048 Fetal Bovine Serum (FBS) GIBCO Cat#1027016 Horse Serum (HS) GIBCO Cat#16050122 Penicillin/streptomycin GIBCO Cat#15140-122 Amphotericin B (fungizone) Sigma Cat#A2942 10S Voltalef oil VWR BDH Prolabo Cat#9002-83-9

Review